Virus:Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems CatAF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..
Recombinant:Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems CatAF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..
Transfection:Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems CatAF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..
SYBR Green Assay:Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems CatAF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..
Polymerase Chain Reaction:Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems CatAF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..
Western Blot:Article Title: Signatures of omicron-like adaptation in early SARS-CoV-2 variants and chronic infection.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies fp.006 Bianchini et al.28 fp.007 Bianchini et al.28 Goat Anti-Human ACE2 primary antibody R&D Systems CatAF933; RRID:AB_355722 Donkey Anti-Goat IgG H&L secondary antibody Abcam #ab150131; RRID:AB_2732857 Anti-Human TMPRSS2 Alexa Fluor 488-conjugated antibody R&D Systems Cat#FAB10723G; RRID:AB_3645473 rabbit anti-SARS-CoV-2 Spike antibody Thermofisher Scientific Cat# PA1-41165; RRID:AB_1087210, LOT:WE3286564 mouse anti-HIV-1 p55/p24 BEI Resources Cat# ARP-3537; RRID:AB_3086785 mouse anti-Spike monoclonal GeneTex Cat# GTX632604; RRID:AB_2864418; clone 1A9 mouse anti-HA-tag Biolegend Cat# 901516; RRID:AB_2820200; clone 16B12 rabbit anti-p24 CFAR Cat#ARP432 mouse Anti-Alpha-Tubulin Sigma-Aldrich Cat#MABT205; RRID:AB_11204167; cloneDM1A Bacterial and virus strains XL10-Gold Ultracompetent Cells Agilent Cat#200314 Biological samples Human sera Chemicals, peptides, and recombinant proteins E64d Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Cell lyisis buffer Cell Signaling Technology Cat#9803 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Amersham ECL Prime Cytivia Cat#RPN2232 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A CaLu-3 Paul Lehner N/A HeLa-ACE2 James Voss N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A Caco-2 ATCC HTB-37 Experimental models: Organisms/strains Human serum samples from SARS-CoV-2 AdV vaccine recipients Collected at NIHR BioResource Center, Cambridge Oligonucleotides SARS-CoV-2_Spike_P812S_FWD:GCCCG ATCCTAGCAAGAGCAGCAAGCGGAGC This paper NA (Continued on next page) Cell Reports 44, 116135, August 26, 2025 15 ..
|
R&D Systems is a verified supplier 
R&D Systems manufactures this product 